View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0592_high_16 (Length: 228)
Name: NF0592_high_16
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0592_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 3698122 - 3698254
Alignment:
| Q |
1 |
gattttcctgaagatgagtttaagaaagcttttagaatgggaaaatcaacttttgatttgatttgtgaagaactgaattcagcaattgtgaaagaagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
3698122 |
gattttcctgaagatgagtttaagaaagcatttagaatgggaaaatcaacttttgatttgatttgtgaagaattgaattcagcaattgtgaaagaagata |
3698221 |
T |
 |
| Q |
101 |
caactttgagaactgcaattccagtgagacaaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3698222 |
caactttgagaactgcaattccagtgagacaaa |
3698254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 3701810 - 3701942
Alignment:
| Q |
1 |
gattttcctgaagatgagtttaagaaagcttttagaatgggaaaatcaacttttgatttgatttgtgaagaactgaattcagcaattgtgaaagaagata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
3701810 |
gattttcctgaagatgagtttaagaaagcttttagaatgggaaaatcaacttttgattttatttgtgaaaaattgaattcagcaattgtgaaagaagata |
3701909 |
T |
 |
| Q |
101 |
caactttgagaactgcaattccagtgagacaaa |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3701910 |
caactttgagaactgcaattccagtgagacaaa |
3701942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University