View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0592_low_10 (Length: 403)
Name: NF0592_low_10
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0592_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 59 - 351
Target Start/End: Original strand, 4133979 - 4134271
Alignment:
Q |
59 |
taactttttaggttttattgtttaaaaattagaaccctcaaaattattgatttttaattgcaatttccatgttttattattttaaggtatggatacaaac |
158 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
4133979 |
taactttttaggttttattgtttaaaaattagaaccctcaaaattattgatttttaattgcaatttccatgttttattattgtaaggtatggatacaaac |
4134078 |
T |
 |
Q |
159 |
cagaagggcatgagggcgacgacatcgaactcggaacctaaaagatagaacgaaagaaaatgagaagatgaataatgaaaagaggttagattagaggaat |
258 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4134079 |
cagaagggcatgagggcgacgacatcgaactcggaacctaaaagatagaacgaaagaaaatgagaagatgaataatgaaaagaggttagattagaggaat |
4134178 |
T |
 |
Q |
259 |
atgaagaagggtacctgagaattgatgctttgaaggtttgggtttgaattcatcaaaatccaacaaaagagttatacaagataatgttaaaag |
351 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4134179 |
atgaagaagggtacctgagaattgatgctttgaaggtttgggtttgaattcatcaaaatccaacaaaagagttatacaagataatgttaaaag |
4134271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2748 times since January 2019
Visitors: 3823