View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0592_low_12 (Length: 376)
Name: NF0592_low_12
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0592_low_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 9 - 348
Target Start/End: Complemental strand, 32539581 - 32539242
Alignment:
Q |
9 |
agcagagagatgagaatttggtattccacatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaattcctc |
108 |
Q |
|
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32539581 |
agcagagagatgagaatttggtattccgcatgttgttgcaacttgtaaactattggaatttaattctgcaattatggttaaaagctcaattgaattcctc |
32539482 |
T |
 |
Q |
109 |
aaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcagtttcatcttcacaagaatctcactctcat |
208 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
32539481 |
aaactttttatcttaagctcttttattgtcccttgatcatgtactaacttgtcaatattctcaatactcaatttcatcttcacaagaatctcactctcat |
32539382 |
T |
 |
Q |
209 |
tatcatatgattctgaactgttttttcttctgaccaagtaagaatgacacttctcaaagattgttttcctgaaaaaattgtcttttatatatctttcaac |
308 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32539381 |
tatcacatgattctgaactgttttttcttctgaccaagtaagaatgacacttctcaaagattgttttcctgaaaaaattgtcttttatatatctttcaac |
32539282 |
T |
 |
Q |
309 |
gtagtcactgaggatactaaccaatgctctgattgcaact |
348 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32539281 |
gtagtcactgaggatactaaccaatgctctgattgcaact |
32539242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University