View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0592_low_21 (Length: 304)
Name: NF0592_low_21
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0592_low_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 31 - 263
Target Start/End: Complemental strand, 12682625 - 12682393
Alignment:
Q |
31 |
atagcgtccaagaatctcttatgtaactcctcttgtttctcaacaacctccttcattagtctctcaaagaaatccttccatttcctcttcctcttccgcc |
130 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12682625 |
atagcttccaagaatctcttatgtaactcctcttgtttctcaacaacctccttcattagtctctcaaagaaatccttccatttcctcttcctcttccgcc |
12682526 |
T |
 |
Q |
131 |
gattcgatcccccttccattgtcgtcgtttcctcagaagaagttgaagacgaacttgaattcgagaagaaatctgttgaaatgttggggaatgatgatgg |
230 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12682525 |
gattcgatcccccttccattgtcgtcgtttcctcagaagaagttgaagacgaacttgaattcgagaagaaatctgttgaaatgttggggaatgatgatgg |
12682426 |
T |
 |
Q |
231 |
tgggggtgttgtagtaatttgaggaatagggtt |
263 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
12682425 |
tgggggtgttgtagtaatttgaggaatagggtt |
12682393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 360 times since January 2019
Visitors: 3833