View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0592_low_22 (Length: 288)
Name: NF0592_low_22
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0592_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 4 - 121
Target Start/End: Original strand, 38733502 - 38733619
Alignment:
| Q |
4 |
gatgaatcctctgactctgaagaaaaacctgagtaatctctcttactctcactctttcatttgcattgttttttaacttctgctttgtgctttgttttac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38733502 |
gatgaatcctctgactctgaagaaaaacctgagtaatctctcttactctcactctttcatacgcattgttttttaacttctgctttgtgctttgttttac |
38733601 |
T |
|
| Q |
104 |
tagattcatgttttgatc |
121 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
38733602 |
tagattcatgttttgatc |
38733619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3104 times since January 2019
Visitors: 3831