View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0592_low_22 (Length: 288)

Name: NF0592_low_22
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0592_low_22
NF0592_low_22
[»] chr2 (1 HSPs)
chr2 (4-121)||(38733502-38733619)


Alignment Details
Target: chr2 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 4 - 121
Target Start/End: Original strand, 38733502 - 38733619
Alignment:
4 gatgaatcctctgactctgaagaaaaacctgagtaatctctcttactctcactctttcatttgcattgttttttaacttctgctttgtgctttgttttac 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
38733502 gatgaatcctctgactctgaagaaaaacctgagtaatctctcttactctcactctttcatacgcattgttttttaacttctgctttgtgctttgttttac 38733601  T
104 tagattcatgttttgatc 121  Q
    ||||||||||||||||||    
38733602 tagattcatgttttgatc 38733619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University