View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0592_low_27 (Length: 253)
Name: NF0592_low_27
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0592_low_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 3783760 - 3784004
Alignment:
Q |
1 |
aacaaacatgccatggatcactttgaggtatgagtatcaagcgtgcttggtgcgtactggttactgcatggtgagctgtctgaccactatgttctttacc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3783760 |
aacaaacatgccatggatcactttgaggtatgagtatcaagcgtgcttggtgcgtactggttactgcatggtgagctgtctgaccactatgttctttacc |
3783859 |
T |
 |
Q |
101 |
tgtctccacttccaatagtatcccctctccttattgtcttccttcttaaagaaaacaaaagacaaaccaaagacataaaatgcgcacaacatagacatac |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3783860 |
tgtctccacttccaatagtatcccctctccttattgtcttccttcttaaagaaaacaaaagacaaaccaaagacataaaatgcgcacaacatagacatac |
3783959 |
T |
 |
Q |
201 |
atagcgacaaactcattcacaaaatcactttaattttcctatgct |
245 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3783960 |
atagcgacaaactcattcacaaaatcactttaattttcctatgct |
3784004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University