View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0592_low_31 (Length: 228)

Name: NF0592_low_31
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0592_low_31
NF0592_low_31
[»] chr7 (4 HSPs)
chr7 (6-111)||(29934728-29934833)
chr7 (10-73)||(30056191-30056254)
chr7 (6-80)||(30072704-30072778)
chr7 (6-74)||(29729790-29729858)


Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 6 - 111
Target Start/End: Complemental strand, 29934833 - 29934728
Alignment:
6 aaggatgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaatatgaccgattaccatgtttctaagatcacgt 105  Q
    ||||||||||||||||||||||||||| |||||  |||| |||||||| ||| ||||||  |||||||||||||||||||||||||||||||||||||||    
29934833 aaggatgaagcgagacatagatgcaaaggaaggcctatgtggcattgcaatgaatgctttttacccaatatgaccgattaccatgtttctaagatcacgt 29934734  T
106 tctttc 111  Q
    ||||||    
29934733 tctttc 29934728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 10 - 73
Target Start/End: Complemental strand, 30056254 - 30056191
Alignment:
10 atgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaa 73  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||    
30056254 atgaagcgagacatagatgcaaaagaaggtttatgcggcattccgatggatgcttcttacccaa 30056191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 30072778 - 30072704
Alignment:
6 aaggatgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaatatgacc 80  Q
    |||||||||||  |||||||||||||| ||||| |||||||||||||||||||| ||||| | |||||| |||||    
30072778 aaggatgaagcacgacatagatgcaaaggaaggcttatgcggcattgcgatggaggcttcttgcccaatctgacc 30072704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 74
Target Start/End: Complemental strand, 29729858 - 29729790
Alignment:
6 aaggatgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaat 74  Q
    |||||| |||||||||||||||||||| |||||  |||| |||||||| ||| |  |||| ||||||||    
29729858 aaggattaagcgagacatagatgcaaaggaaggcctatgtggcattgcaatgaaaccttcttacccaat 29729790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University