View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0592_low_31 (Length: 228)
Name: NF0592_low_31
Description: NF0592
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0592_low_31 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 74; Significance: 4e-34; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 6 - 111
Target Start/End: Complemental strand, 29934833 - 29934728
Alignment:
| Q |
6 |
aaggatgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaatatgaccgattaccatgtttctaagatcacgt |
105 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |||| |||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29934833 |
aaggatgaagcgagacatagatgcaaaggaaggcctatgtggcattgcaatgaatgctttttacccaatatgaccgattaccatgtttctaagatcacgt |
29934734 |
T |
 |
| Q |
106 |
tctttc |
111 |
Q |
| |
|
|||||| |
|
|
| T |
29934733 |
tctttc |
29934728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 10 - 73
Target Start/End: Complemental strand, 30056254 - 30056191
Alignment:
| Q |
10 |
atgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaa |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
30056254 |
atgaagcgagacatagatgcaaaagaaggtttatgcggcattccgatggatgcttcttacccaa |
30056191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 6 - 80
Target Start/End: Complemental strand, 30072778 - 30072704
Alignment:
| Q |
6 |
aaggatgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaatatgacc |
80 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| |||||||||||||||||||| ||||| | |||||| ||||| |
|
|
| T |
30072778 |
aaggatgaagcacgacatagatgcaaaggaaggcttatgcggcattgcgatggaggcttcttgcccaatctgacc |
30072704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 6 - 74
Target Start/End: Complemental strand, 29729858 - 29729790
Alignment:
| Q |
6 |
aaggatgaagcgagacatagatgcaaaagaaggtttatgcggcattgcgatggatgcttcatacccaat |
74 |
Q |
| |
|
|||||| |||||||||||||||||||| ||||| |||| |||||||| ||| | |||| |||||||| |
|
|
| T |
29729858 |
aaggattaagcgagacatagatgcaaaggaaggcctatgtggcattgcaatgaaaccttcttacccaat |
29729790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University