View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_15 (Length: 429)
Name: NF0593_high_15
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 1 - 406
Target Start/End: Complemental strand, 11333984 - 11333574
Alignment:
Q |
1 |
tcatcacgatacagaacacgacatgcacgaagaaaacaatgtagcgttactcttcacatcagacggtggagcaacgctaaacggtcttctagaaaatgaa |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11333984 |
tcatcacgatacagaacacgacatgcacgaagaaaacaatgtagcgttactcttcacatcagacggtggagcaacgctaaacggtcttctagaaaatgaa |
11333885 |
T |
 |
Q |
101 |
tcgacaacgttgacaacgacggaggaagaggaggagtc--------tgatgatgtccatctcattgatggatcaagggttggtgaggaaagcaatgagga |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |||||| || || | |||||||||||||||||||||||||||||||||||| |
|
|
T |
11333884 |
tcgacaacgttgacaacgacggaggaagaggaggagtcattgtcagtgatgaagtg--tc-cggtgatggatcaagggttggtgaggaaagcaatgagga |
11333788 |
T |
 |
Q |
193 |
ggaagaggaatgatgaagagagtgaagagagatgggtgagttattcagaagttgttgaagagaccaagaaggaaattatggaggaagttaatagtacttg |
292 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
T |
11333787 |
ggaagaggaatgatgaagagagtgaagagagatgggtgagttattcagaagttgttgaagaaacgaagaaggaaattatggaggaagttaatagtacttg |
11333688 |
T |
 |
Q |
293 |
ttttggatttgaaacgacgtcgttttttgggtctttgagtttgaagttggatcatgatgggatattgaatgcttggtctgataaaggttctctttatgtt |
392 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11333687 |
ttttggatttgaaacgacgtcgttttttgggtctttgagtttgaagttggatcatgatgggatattgaatgcttggtctgataaaggttctctttatgtt |
11333588 |
T |
 |
Q |
393 |
gatggttgtgatga |
406 |
Q |
|
|
|||||||||||||| |
|
|
T |
11333587 |
gatggttgtgatga |
11333574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 685 times since January 2019
Visitors: 3837