View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_16 (Length: 428)
Name: NF0593_high_16
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 44; Significance: 7e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 30 - 81
Target Start/End: Complemental strand, 35919895 - 35919844
Alignment:
Q |
30 |
aaattattacatccaagggtaaagatcaaaagatataatccaaaggcctctg |
81 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
35919895 |
aaattattacatccaagggtggagatcaaaagatataatccaaaggcctctg |
35919844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1223 times since January 2019
Visitors: 3841