View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_21 (Length: 398)
Name: NF0593_high_21
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-134; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 33 - 338
Target Start/End: Original strand, 11176152 - 11176455
Alignment:
| Q |
33 |
atatgtgcttatattcatggatggttggagtacttacctaaacaaaatggttatgacaaaaatactctccatagatggaacaaaatcaagtaaaatggtt |
132 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11176152 |
atatgtgcttatattcaaggatggtaggagtacttacctaaacaaaatggttatgacaaaaatactctccatagatggaacaaaatcaagtaaaatggtt |
11176251 |
T |
 |
| Q |
133 |
caattaattggagttgaaccgaatctagcatcgatgctttgggtggattacacagcaggcttgtcacgacgtgatcatttccttttcttctaaaaaattc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
11176252 |
caattaattggagttgaaccgaatctagcatcgatgctttgggtggattacacagtaggcttgtcacgacgtgatcacttccttttcttctaaaaaattc |
11176351 |
T |
 |
| Q |
233 |
acttttagacaaccaa-attattttannnnnnnngagcaaatatgagttcctttatcgaaattaaacaaataggaaaacatatactcctattgtgtttat |
331 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11176352 |
acttttagacaaccaattttatttt---ttttttgagcaaatatgagttcctttattgaaattaaacaaataggaaaacatatactcctattgtgtttat |
11176448 |
T |
 |
| Q |
332 |
ataagag |
338 |
Q |
| |
|
||||||| |
|
|
| T |
11176449 |
ataagag |
11176455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 145 - 216
Target Start/End: Original strand, 11163112 - 11163180
Alignment:
| Q |
145 |
gttgaaccgaatctagcatcgatgctttgggtggattacacagcaggcttgtcacgacgtgatcatttcctt |
216 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||||| | ||||||||| |||||||| ||||||| |
|
|
| T |
11163112 |
gttgaacggaatctagcatcgatgctttgggtgga-tacactg--agcttgtcacaacgtgatcctttcctt |
11163180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University