View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_33 (Length: 324)
Name: NF0593_high_33
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_high_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 86 - 309
Target Start/End: Original strand, 11715470 - 11715693
Alignment:
| Q |
86 |
gttacatggagtacttaaaaaagaatttatttgcatacctataggtacattgattttccaattttgtgtcttggaaatttttcgatctctccttttgcca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11715470 |
gttacatggagtacttaaaaaagaatttatttgcatacctataggtacattgattttccaattttgtgtcttggaaatttttcgatctctccttttgcca |
11715569 |
T |
 |
| Q |
186 |
ttgctgaaaaggagcnnnnnnntatgaatatcgtctttgaaaaattgatgcaatttctctaaacaaaagcgagaggcataaggttatgtatttacaatgt |
285 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11715570 |
ttgctgaaaaggagcaaaaaaatatgaatatcgtctttgaaaaattgatgcaatttctctaaacaaaagcgagaggcataaggttatgtatttacaatgt |
11715669 |
T |
 |
| Q |
286 |
catatattcgagcattccaatcat |
309 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11715670 |
catatattcgagcattccaatcat |
11715693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University