View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_35 (Length: 307)
Name: NF0593_high_35
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 64 - 216
Target Start/End: Complemental strand, 7750417 - 7750266
Alignment:
| Q |
64 |
ttgtacaataattatgagttaacatcttcgttagaatttgaatcgcaattaaccgtgttttcttaatttccttcaccactcaagctcgttgatatcttta |
163 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7750417 |
ttgtacaataattatgagttcacatcttcgttagaatttgaaccgcaattaaccgtgttttcttaatttccttcaccactcaagctcgttgatatcttta |
7750318 |
T |
|
| Q |
164 |
aactatctttaggtgggttcatatttatttagttattggtgagataaaaagga |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7750317 |
aactatc-ttaggtgggttcatatttatttagttattgttgagataaaaagga |
7750266 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 259 - 295
Target Start/End: Complemental strand, 7750269 - 7750233
Alignment:
| Q |
259 |
aggattcattaaattaaattgtcgcctttctgttcat |
295 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
7750269 |
aggattcaataaattaaattgtcacctttctgttcat |
7750233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1458 times since January 2019
Visitors: 3846