View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_50 (Length: 269)
Name: NF0593_high_50
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_high_50 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 9e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 9e-76
Query Start/End: Original strand, 89 - 244
Target Start/End: Complemental strand, 7691436 - 7691281
Alignment:
| Q |
89 |
ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcagttcttccgtcttaattttcttgttaagaatattataacaagttat |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691436 |
ttacagccagagaattgcagttgcagaccgcaatttagaactattagcattgcaattcttttgtcttaattttcttgttaagaatattataacaagttat |
7691337 |
T |
 |
| Q |
189 |
gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatgat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7691336 |
gaagatgtttatcatttttattgttctatcacagatagatcacaattgcctatgat |
7691281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 40 - 90
Target Start/End: Complemental strand, 7691511 - 7691461
Alignment:
| Q |
40 |
ttaccatacaatgcggataaatatgcccgcagttgtattttcaatgtcgtt |
90 |
Q |
| |
|
|||| |||||||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
7691511 |
ttacgatacaatgcggataaatatgaccgcaattgtattttcaatgtcgtt |
7691461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University