View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_51 (Length: 269)
Name: NF0593_high_51
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_high_51 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 28 - 241
Target Start/End: Complemental strand, 42141420 - 42141207
Alignment:
Q |
28 |
gtgcatgcaagacaaatgaggcttttatccgttattgcctcgttgtctttgtgtttttggtggtggnnnnnnngacagcaccgtataagctagaagggaa |
127 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
42141420 |
gtgcatgcaagacaaatgaggcttttatccgttattgcctcgttgtctttgtgtttttggtggtggtttttttgacagcaccgtataagctagaagggaa |
42141321 |
T |
 |
Q |
128 |
aaagaaaggacaatgcagtgaatccacattgctattgctattgctatgtttacagacttacagttaggtccagaattggaccatgctttgtacccaaata |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42141320 |
aaagaaaggacaatgcagtgaatccacattgctattgctattgctatgtttacagacttacagttaggtccagaattggaccatgctttgtacccaaata |
42141221 |
T |
 |
Q |
228 |
aacccgttcggtct |
241 |
Q |
|
|
|||||||||||||| |
|
|
T |
42141220 |
aacccgttcggtct |
42141207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1087 times since January 2019
Visitors: 3839