View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_55 (Length: 261)
Name: NF0593_high_55
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_high_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 135 - 250
Target Start/End: Complemental strand, 45346019 - 45345904
Alignment:
| Q |
135 |
atgcttctgattcaagagtttgagtttcaggatcctacaggttcagttggtgctagtatccaccgcaaagtcttcactgaaggaggatttagaaaggata |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346019 |
atgcttctgattcaagagtttgagtttcaggatcctacaggttcagttggtgctagtatccaccgcaaagtcttcactgaaggaggatttagaaaggata |
45345920 |
T |
|
| Q |
235 |
taactgttggttctgt |
250 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
45345919 |
taactgttggttctgt |
45345904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 45346158 - 45346059
Alignment:
| Q |
1 |
ctgaacggtgaaggaaaagttccgagtatcgtagctgttatcaaatcatgcactcctaacggttttggagacatgacggttaccctaaaggtcctgttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45346158 |
ctgaacggtgaaggaaaagttccgagtatcgtagctgttatcaaatcatgcactcctaacggttttggagacatgacggttaccctaaaggtcctgttct |
45346059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1444 times since January 2019
Visitors: 3846