View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_high_67 (Length: 212)

Name: NF0593_high_67
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_high_67
NF0593_high_67
[»] chr7 (1 HSPs)
chr7 (1-30)||(6531199-6531228)


Alignment Details
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 6531199 - 6531228
Alignment:
1 tgagaacttaatttacattttgcaagcaaa 30  Q
    ||||||||||||||||||||||||||||||    
6531199 tgagaacttaatttacattttgcaagcaaa 6531228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 843 times since January 2019
Visitors: 3837