View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_67 (Length: 212)
Name: NF0593_high_67
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_high_67 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 6531199 - 6531228
Alignment:
Q |
1 |
tgagaacttaatttacattttgcaagcaaa |
30 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
6531199 |
tgagaacttaatttacattttgcaagcaaa |
6531228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 843 times since January 2019
Visitors: 3837