View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_68 (Length: 212)
Name: NF0593_high_68
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_high_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 12181079 - 12181181
Alignment:
Q |
1 |
caaaaattgtctgagaatgtaaaattggttggaaggtgttatactagcatgttataatttggttgagaatgtgaaattaattggtagcagtactctctgc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
12181079 |
caaaaattgtctgagaatgtaaaattggttggaaggtgttatactagcatgttataatttggttgagaatgtgaaattaattggtagcagtactgtctgc |
12181178 |
T |
 |
Q |
101 |
tcc |
103 |
Q |
|
|
||| |
|
|
T |
12181179 |
tcc |
12181181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University