View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_high_68 (Length: 212)

Name: NF0593_high_68
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_high_68
NF0593_high_68
[»] chr7 (1 HSPs)
chr7 (1-103)||(12181079-12181181)


Alignment Details
Target: chr7 (Bit Score: 99; Significance: 5e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 12181079 - 12181181
Alignment:
1 caaaaattgtctgagaatgtaaaattggttggaaggtgttatactagcatgttataatttggttgagaatgtgaaattaattggtagcagtactctctgc 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
12181079 caaaaattgtctgagaatgtaaaattggttggaaggtgttatactagcatgttataatttggttgagaatgtgaaattaattggtagcagtactgtctgc 12181178  T
101 tcc 103  Q
    |||    
12181179 tcc 12181181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University