View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_high_71 (Length: 204)
Name: NF0593_high_71
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_high_71 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 6e-67; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 3575625 - 3575757
Alignment:
Q |
1 |
aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3575625 |
aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga |
3575724 |
T |
 |
Q |
101 |
agaatcaccatgaggaaaacaaccaccaagaag |
133 |
Q |
|
|
||||||||||||||||||||||||| ||||||| |
|
|
T |
3575725 |
agaatcaccatgaggaaaacaaccaacaagaag |
3575757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 3585593 - 3585461
Alignment:
Q |
1 |
aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga |
100 |
Q |
|
|
|||||||| ||||||| | ||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
3585593 |
aaatactacaatggctgcttcaacaatggctctctcatcttcatcaatggttggaaaggcaatcaagctttccccttcgactccagaccttgtgatggga |
3585494 |
T |
 |
Q |
101 |
agaatcaccatgaggaaaacaaccaccaagaag |
133 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
3585493 |
agaatcaccatgaggaaaacaaccaccaagaag |
3585461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 11 - 133
Target Start/End: Original strand, 3572351 - 3572473
Alignment:
Q |
11 |
atggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatgggaagaatcacca |
110 |
Q |
|
|
|||||| | ||||||||| |||||||||||||| || |||||||||||||||||||||||||||| || |||||||||||||| ||||||||||| |||| |
|
|
T |
3572351 |
atggctgcttcaacaatgtctctctcttcttcatcattggttgggaaggcaatcaagctttccccctctactccagaccttgtcatgggaagaattacca |
3572450 |
T |
 |
Q |
111 |
tgaggaaaacaaccaccaagaag |
133 |
Q |
|
|
||||||||||||||||||||||| |
|
|
T |
3572451 |
tgaggaaaacaaccaccaagaag |
3572473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 3563646 - 3563779
Alignment:
Q |
1 |
aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga |
100 |
Q |
|
|
|||||||| |||||| | ||||||||| |||||||||||||| || | || ||||||||||||||||||||||| ||||| | |||| ||| | ||||| |
|
|
T |
3563646 |
aaatactaaaatggcggcttcaacaatgtctctctcttcttcatcatttgtagggaaggcaatcaagctttccccatccacccaagacattggggtggga |
3563745 |
T |
 |
Q |
101 |
agaatcaccatgaggaaaacaaccaccaagaagt |
134 |
Q |
|
|
||| |||| ||||||||| ||||||||||||||| |
|
|
T |
3563746 |
agagtcacaatgaggaaagcaaccaccaagaagt |
3563779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 3569294 - 3569427
Alignment:
Q |
1 |
aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga |
100 |
Q |
|
|
|||||| | ||||||| | ||||||||| | |||||||||||| || | || |||||||||||||| |||||||| ||||||| |||| ||| | ||||| |
|
|
T |
3569294 |
aaataccacaatggctgcttcaacaatgtccctctcttcttcatcatttgtcgggaaggcaatcaaactttccccatccactcaagacattggggtggga |
3569393 |
T |
 |
Q |
101 |
agaatcaccatgaggaaaacaaccaccaagaagt |
134 |
Q |
|
|
||| |||| ||||||||||||||||||||||||| |
|
|
T |
3569394 |
agagtcacaatgaggaaaacaaccaccaagaagt |
3569427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 132
Target Start/End: Original strand, 13275587 - 13275708
Alignment:
Q |
10 |
aatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatgggaagaatcacc |
109 |
Q |
|
|
||||||| | ||||||||| |||||||||||||| || ||||||| ||||||||||| ||| ||| || || | |||||||| || ||||| ||||| |
|
|
T |
13275587 |
aatggctgcctcaacaatgtctctctcttcttcatcattggttggaaaggcaatcaaacttaacccctctacccaagaccttggtattggaagggtcacc |
13275686 |
T |
 |
Q |
110 |
atgaggaaaacaaccaccaagaa |
132 |
Q |
|
|
|||| ||||||||||| ||||| |
|
|
T |
13275687 |
atga-aaaaacaaccacaaagaa |
13275708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University