View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_18 (Length: 447)
Name: NF0593_low_18
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 12181079 - 12181412
Alignment:
| Q |
1 |
caaaaattgtctgagaatgtaaaattggttggaaggtgttatactagcatgttataatttggttgagaatgtgaaattaattggtagcagtactctctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
12181079 |
caaaaattgtctgagaatgtaaaattggttggaaggtgttatactagcatgttataatttggttgagaatgtgaaattaattggtagcagtactgtctgc |
12181178 |
T |
|
| Q |
101 |
tcccttattatccaccgtatttgcagtctg-aaactaatagttacattgttctaactctcaagagaccttattgcatctgttgggctagcaaaggataaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12181179 |
tcccttattatccaccgtatttgcagtctgaaaactaatagttacattgttctaacactcaagagaccttattgcatctgttgggctagcaaaggataaa |
12181278 |
T |
|
| Q |
200 |
agcgtacgcatccattatttccaccgaacagaa------------gggttggcttcagtacacatatcatctaattctatgaaataagttcataactcat |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||| |||| ||||||||||||||||||||| |||||||| |
|
|
| T |
12181279 |
agcgtacgcatccattatttccaccgaacagaaggctgttcgtggggtttggcttcagtacac--atcacctaattctatgaaataagttcgtaactcat |
12181376 |
T |
|
| Q |
288 |
agttgaatcaataaacaatgtcgaaattcctatatc |
323 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
12181377 |
agttcaatcaataaacaatgtccaaattcctatatc |
12181412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1102 times since January 2019
Visitors: 3839