View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_24 (Length: 409)
Name: NF0593_low_24
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 351; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 351; E-Value: 0
Query Start/End: Original strand, 14 - 380
Target Start/End: Complemental strand, 7404782 - 7404416
Alignment:
| Q |
14 |
agatatccacgataagaacagatggaggattcttcatggattggatttcagagcgaataaaaggaagagattcaatcattgttaaaacaatttgtaatcc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7404782 |
agatatccacgataagaacagatggaggattcttcatagattggatttcagagcgaataaaaggaagagattcaatcattgttaaaacaatttgtaatcc |
7404683 |
T |
 |
| Q |
114 |
taaggatggattgtttgggtcaagtttgtcggagacatcgacaggaggtgttacaatgatgtcgaggctattagggtttgatatttgttgaagtatatgt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7404682 |
taaggatggattgtttgggtcaagtttgtcggagacatcgacaggaggtgttacaatgatgtcgaggctattaaggtttgatatttgttgaagtatatgt |
7404583 |
T |
 |
| Q |
214 |
gattttgttttgtctgaatctgaggtggcggttgtgacgacgaagatggttacgtcgaaattatggtgggtggtaagacgtttgcctaattcaatggtgg |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7404582 |
gattttgttttgtctgaatctgaggtggcggttgtgacgacgaagatggttacgtcgaaattatggtgggtggtaagacgtttgcctaattcaatggtgg |
7404483 |
T |
 |
| Q |
314 |
gaattaggtgtcccatgccaggactggctagaaggactgaatgaattttttgggacaccatggttac |
380 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
7404482 |
gaattaggtgtcctatgccaggactggctagaaggactgagtgaattttttgggacaccatggttac |
7404416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University