View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_low_30 (Length: 380)

Name: NF0593_low_30
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_low_30
NF0593_low_30
[»] chr8 (4 HSPs)
chr8 (1-370)||(35911183-35911550)
chr8 (5-77)||(9528908-9528980)
chr8 (5-77)||(35916269-35916341)
chr8 (5-77)||(20112825-20112897)
[»] chr4 (9 HSPs)
chr4 (180-370)||(37236679-37236872)
chr4 (227-370)||(33907489-33907632)
chr4 (251-370)||(12104664-12104781)
chr4 (5-77)||(27972657-27972729)
chr4 (5-77)||(37235944-37236016)
chr4 (5-77)||(38584093-38584165)
chr4 (5-77)||(38843710-38843782)
chr4 (5-77)||(41303623-41303695)
chr4 (5-77)||(52208008-52208080)
[»] chr7 (2 HSPs)
chr7 (5-77)||(48926627-48926699)
chr7 (5-77)||(6055067-6055139)
[»] chr5 (3 HSPs)
chr5 (5-77)||(4308725-4308797)
chr5 (5-77)||(4312556-4312628)
chr5 (5-77)||(30364371-30364443)
[»] chr3 (1 HSPs)
chr3 (5-77)||(26286777-26286849)
[»] chr1 (1 HSPs)
chr1 (5-77)||(42321477-42321549)


Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 370
Target Start/End: Original strand, 35911183 - 35911550
Alignment:
1 caagtccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaagtttcatttttgttacatcaann 100  Q
    ||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |||| |||||||| ||||||      
35911183 caagtccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaattttcttttttgtttcatcaatt 35911282  T
101 nnnnnnnc--ctgttctctttcgtatatatatgtatatannnnnnnnnaagaggttctctttcatatatttatgtcgcatagtgtagcatcattctcgtc 198  Q
           |  |||||||||||||||||||||| ||| |          || ||||||||||||||||||||||||||| |||||||||||||||||||||    
35911283 tttttttctcctgttctctttcgtatatatatttattt----tttttaaaaaggttctctttcatatatttatgtcgcgtagtgtagcatcattctcgtc 35911378  T
199 actgtcttggtctttggatagacaacaatgtcatatgtatcgaaaactataccaacctctttaccttatcacactcataaaaccacttcaaattacacnn 298  Q
    |||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |      
35911379 actgtcttggtctttggatagacaacaatgtcatctgtgtcgaaaactataccaatctcttcaccttatcacactcataaaaccacttcaaattacgcaa 35911478  T
299 nnnnntctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg 370  Q
         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35911479 aaaaatctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg 35911550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 9528980 - 9528908
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |||||||    
9528980 tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa 9528908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 35916269 - 35916341
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |||||||    
35916269 tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa 35916341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 20112825 - 20112897
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
20112825 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 20112897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 143; Significance: 5e-75; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 180 - 370
Target Start/End: Original strand, 37236679 - 37236872
Alignment:
180 gtgtagcatcattctcgtcactgtcttggtctttggatagacaacaatgtcatatgtatcgaaaactataccaacctctttaccttatcacactcataaa 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||    
37236679 gtgtagcatcattctcgtcactgtcttggtctttggatagacaacaatgtcatctgtgtcgaaaactataccaacctcttcaccttatcacactcataaa 37236778  T
280 accacttcaaattacac---nnnnnnntctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg 370  Q
    |||||||||||||||||          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37236779 accacttcaaattacacaaaaaaaaaatcttataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg 37236872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 227 - 370
Target Start/End: Original strand, 33907489 - 33907632
Alignment:
227 tgtcatatgtatcgaaaactataccaacctctttaccttatcacactcataaaaccacttcaaattacacnnnnnnntctcataaccgcttcatcttctt 326  Q
    |||||| ||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||    
33907489 tgtcatctgtgtcgaaaactataccaacctcttcaccttatcacactcataaaaccacttcaaattacacaaaaaaatctcataaccgcttcatcttctt 33907588  T
327 caaacaacctcgtagaacatgtcttctacattccactgtctgtg 370  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
33907589 caaacaacctcgtagaacatgtcttctacattccactgtctgtg 33907632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 251 - 370
Target Start/End: Original strand, 12104664 - 12104781
Alignment:
251 caacctctttaccttatcacactcataaaaccacttcaaattacacnnnnnnntctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtct 350  Q
    |||||| || ||||||||||||||||||||||||||| ||||||||       |||||| ||||||| |||||||||||||||||||||| || ||||||    
12104664 caaccttttcaccttatcacactcataaaaccacttccaattacacaaaaaa-tctcatcaccgctt-atcttcttcaaacaacctcgtacaatatgtct 12104761  T
351 tctacattccactgtctgtg 370  Q
    ||| ||||||||||||||||    
12104762 tctgcattccactgtctgtg 12104781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 27972729 - 27972657
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |||||||    
27972729 tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa 27972657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 37235944 - 37236016
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |||||||    
37235944 tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa 37236016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 38584165 - 38584093
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| |||||||    
38584165 tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa 38584093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 38843782 - 38843710
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
38843782 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 38843710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 41303695 - 41303623
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
41303695 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 41303623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 52208008 - 52208080
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
52208008 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 52208080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 48926627 - 48926699
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    |||||||||||||||||||| |||||||| | ||||||||||||| ||||||||||||||||||| |||||||    
48926627 tccgttgtagtctagttggttaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa 48926699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 6055067 - 6055139
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
6055067 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 6055139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 4308725 - 4308797
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
4308725 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 4308797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 4312556 - 4312628
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
4312556 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 4312628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 30364371 - 30364443
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
30364371 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 30364443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 26286777 - 26286849
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
26286777 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 26286849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 42321477 - 42321549
Alignment:
5 tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa 77  Q
    ||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| |||||||    
42321477 tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa 42321549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1198 times since January 2019
Visitors: 3841