View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_30 (Length: 380)
Name: NF0593_low_30
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_30 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 370
Target Start/End: Original strand, 35911183 - 35911550
Alignment:
Q |
1 |
caagtccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaagtttcatttttgttacatcaann |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |||| |||||||| |||||| |
|
|
T |
35911183 |
caagtccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaattttcttttttgtttcatcaatt |
35911282 |
T |
 |
Q |
101 |
nnnnnnnc--ctgttctctttcgtatatatatgtatatannnnnnnnnaagaggttctctttcatatatttatgtcgcatagtgtagcatcattctcgtc |
198 |
Q |
|
|
| |||||||||||||||||||||| ||| | || ||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
35911283 |
tttttttctcctgttctctttcgtatatatatttattt----tttttaaaaaggttctctttcatatatttatgtcgcgtagtgtagcatcattctcgtc |
35911378 |
T |
 |
Q |
199 |
actgtcttggtctttggatagacaacaatgtcatatgtatcgaaaactataccaacctctttaccttatcacactcataaaaccacttcaaattacacnn |
298 |
Q |
|
|
|||||||||||||||||||||||||||||||||| ||| |||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| | |
|
|
T |
35911379 |
actgtcttggtctttggatagacaacaatgtcatctgtgtcgaaaactataccaatctcttcaccttatcacactcataaaaccacttcaaattacgcaa |
35911478 |
T |
 |
Q |
299 |
nnnnntctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg |
370 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35911479 |
aaaaatctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg |
35911550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 9528980 - 9528908
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
9528980 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
9528908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 35916269 - 35916341
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
35916269 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
35916341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 20112825 - 20112897
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
20112825 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
20112897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 143; Significance: 5e-75; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 180 - 370
Target Start/End: Original strand, 37236679 - 37236872
Alignment:
Q |
180 |
gtgtagcatcattctcgtcactgtcttggtctttggatagacaacaatgtcatatgtatcgaaaactataccaacctctttaccttatcacactcataaa |
279 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
37236679 |
gtgtagcatcattctcgtcactgtcttggtctttggatagacaacaatgtcatctgtgtcgaaaactataccaacctcttcaccttatcacactcataaa |
37236778 |
T |
 |
Q |
280 |
accacttcaaattacac---nnnnnnntctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg |
370 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37236779 |
accacttcaaattacacaaaaaaaaaatcttataaccgcttcatcttcttcaaacaacctcgtagaacatgtcttctacattccactgtctgtg |
37236872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 227 - 370
Target Start/End: Original strand, 33907489 - 33907632
Alignment:
Q |
227 |
tgtcatatgtatcgaaaactataccaacctctttaccttatcacactcataaaaccacttcaaattacacnnnnnnntctcataaccgcttcatcttctt |
326 |
Q |
|
|
|||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
33907489 |
tgtcatctgtgtcgaaaactataccaacctcttcaccttatcacactcataaaaccacttcaaattacacaaaaaaatctcataaccgcttcatcttctt |
33907588 |
T |
 |
Q |
327 |
caaacaacctcgtagaacatgtcttctacattccactgtctgtg |
370 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33907589 |
caaacaacctcgtagaacatgtcttctacattccactgtctgtg |
33907632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 251 - 370
Target Start/End: Original strand, 12104664 - 12104781
Alignment:
Q |
251 |
caacctctttaccttatcacactcataaaaccacttcaaattacacnnnnnnntctcataaccgcttcatcttcttcaaacaacctcgtagaacatgtct |
350 |
Q |
|
|
|||||| || ||||||||||||||||||||||||||| |||||||| |||||| ||||||| |||||||||||||||||||||| || |||||| |
|
|
T |
12104664 |
caaccttttcaccttatcacactcataaaaccacttccaattacacaaaaaa-tctcatcaccgctt-atcttcttcaaacaacctcgtacaatatgtct |
12104761 |
T |
 |
Q |
351 |
tctacattccactgtctgtg |
370 |
Q |
|
|
||| |||||||||||||||| |
|
|
T |
12104762 |
tctgcattccactgtctgtg |
12104781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 27972729 - 27972657
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
27972729 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
27972657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 37235944 - 37236016
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
37235944 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
37236016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 38584165 - 38584093
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
38584165 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
38584093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 38843782 - 38843710
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
38843782 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
38843710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Complemental strand, 41303695 - 41303623
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
41303695 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
41303623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 52208008 - 52208080
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
52208008 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
52208080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 48926627 - 48926699
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
|||||||||||||||||||| |||||||| | ||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
48926627 |
tccgttgtagtctagttggttaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
48926699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 6055067 - 6055139
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
6055067 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
6055139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 6e-19; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 4308725 - 4308797
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
4308725 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
4308797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 4312556 - 4312628
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
4312556 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
4312628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 30364371 - 30364443
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
30364371 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
30364443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 26286777 - 26286849
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
26286777 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
26286849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 5 - 77
Target Start/End: Original strand, 42321477 - 42321549
Alignment:
Q |
5 |
tccgttgtagtctagttggtcaggatacttgactctcacccgagatacccgggttcaagtcccggaaacggaa |
77 |
Q |
|
|
||||||||||||||||||||||||||| | | ||||||||||| | ||||||||||||||||||| ||||||| |
|
|
T |
42321477 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
42321549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1198 times since January 2019
Visitors: 3841