View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_31 (Length: 372)
Name: NF0593_low_31
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 273
Target Start/End: Original strand, 40749801 - 40750079
Alignment:
| Q |
1 |
tatttatgatgatggtgacgcacacggtgtgtttaatgtaactttgtaagccaaagaaaacccaacaccctacgacacagcatcctatgcacacccatgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40749801 |
tatttatgatgatggtgacgcacacggtgtgtttaatgtaactttgtaagccaaagaaaacccaacaccctacgacacagcatcctatgcaca-ccatgc |
40749899 |
T |
 |
| Q |
101 |
cgatgagaccgtaa------cataacagtgacaagtaacaccaacattcaaaaagctgtcnnnnnnnnnncaggcga----gtagtttagtgactaaaac |
190 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||| |||||||||||| ||| || ||||||||||||||||||| |
|
|
| T |
40749900 |
cgatgagaccgtaacataaccataaccgtgacaagtaacaccaacatccaaaaagctgtc---tttttttcagttgatccggtagtttagtgactaaaac |
40749996 |
T |
 |
| Q |
191 |
ttcacattttttaagatgaaaagataggttgtctaagcttcgaatctcaatctctacatatattactctacaaatcacctgac |
273 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40749997 |
ttcacattttttaaaatgaaaagataggttgtctaagctttgaatttcaatctctacatatattactctacaaatcacctgac |
40750079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University