View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_33 (Length: 361)
Name: NF0593_low_33
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 30 - 309
Target Start/End: Original strand, 56023544 - 56023823
Alignment:
| Q |
30 |
cgtataacaaccaaaaacacaaattagcaatcaggaaaattaacaaaagtgagcgtagcaccaagagagggaaatgaatttgtgaaacgtacctcaaata |
129 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56023544 |
cgtataactaccaaaatcacaaattagcaatcaggaaaattaacaaaagtgagcgtagcaccaagagagggaaatgaatttgtgaaacgtacctcaaata |
56023643 |
T |
|
| Q |
130 |
gaggcttaaagatgttttctatttcttcttcctttgaacttctaccaccctttttctcttagttctcaccaattacttctgtactttttcttgcgttaag |
229 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56023644 |
gaggcttaaagatgttttctatgtcttcttcctttgaacttctaccaccctttttctcttagttctcaccaattacttctgtactttttcttgcgttaag |
56023743 |
T |
|
| Q |
230 |
ggaggctatttatagagatgtgacaatgcaaatggacatggaaggccgnnnnnnntgaaatcaaattgattgtagaatta |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
56023744 |
ggaggctatttatagagatgtgacaatgcaaatggacatggaaggccgaaaaaaatgaaatcaaattgattgtagaatta |
56023823 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 52; Significance: 9e-21; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 205 - 276
Target Start/End: Original strand, 9320098 - 9320169
Alignment:
| Q |
205 |
cttctgtactttttcttgcgttaagggaggctatttatagagatgtgacaatgcaaatggacatggaaggcc |
276 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
9320098 |
cttctatactttttcttgtgttaagggatgctatttatagagatgtgacaatgcaaatggatattgaaggcc |
9320169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 200 - 276
Target Start/End: Original strand, 9319070 - 9319146
Alignment:
| Q |
200 |
aattacttctgtactttttcttgcgttaagggaggctatttatagagatgtgacaatgcaaatggacatggaaggcc |
276 |
Q |
| |
|
|||| ||||| |||||||||||| ||||||||| |||||||||||||||||| |||||||||||| || ||||||| |
|
|
| T |
9319070 |
aattgcttctatactttttcttgtgttaagggatgctatttatagagatgtggtaatgcaaatggatattgaaggcc |
9319146 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 140 - 177
Target Start/End: Original strand, 9319018 - 9319055
Alignment:
| Q |
140 |
gatgttttctatttcttcttcctttgaacttctaccac |
177 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
9319018 |
gatgttttctttgtcttcttcctttgaacttctaccac |
9319055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2550 times since January 2019
Visitors: 3822