View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_34 (Length: 357)
Name: NF0593_low_34
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_34 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 95 - 286
Target Start/End: Original strand, 5492385 - 5492576
Alignment:
Q |
95 |
aacacaaaatctatttatatgtaaagtgtagatgaatgcaccataaataccccaatttgtatgttttaccaaaattagaaaatgtgatttgaaagttttg |
194 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
5492385 |
aacacaaaatctatgcatatgtaaagtgtagatgaatgcaccataaataccccaatttgtatgctttaccaaaattagaaaatgtgatttgaaagttttg |
5492484 |
T |
 |
Q |
195 |
ttatctatcatgcaagtaagtataaactcccaaaaagggaaaagaatgaagtaacaacttaccatccaaaagagcttcagaaacttcatctc |
286 |
Q |
|
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
5492485 |
ttatctatcatgcaaataagtataaactcccaaagagggaaaagaatgaagtaacaacttaccatccaaaagagcttcagaaacttcatctc |
5492576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 410 times since January 2019
Visitors: 3834