View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_36 (Length: 343)
Name: NF0593_low_36
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 1 - 314
Target Start/End: Original strand, 8253754 - 8254067
Alignment:
Q |
1 |
tcctaaaggtcatgataacatggaagactctttaagctggttaggaatgccctttttaaacttctatcgccaatttaacaagaacttgtttgctagtagc |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8253754 |
tcctaaaggtcatgataacatggaagactctttaagctggttaggaatgccctttttaaacttctatcgccaatttaacaagaacttgtttgctagtagc |
8253853 |
T |
 |
Q |
101 |
cagaagtttgaaacactagttgactacaatcctgtttttgtatcgtccttcgggaagctggaactccaaggtggtgcaaggatgcttcttccgattggta |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8253854 |
cagaagtttgaaacactagttgactacaatcctgtttttgtatcgtccttcgggaagctggaactccaaggtggtgcaaggatgcttcttccgattggta |
8253953 |
T |
 |
Q |
201 |
taaatgacactgtaattccaatatatgatgatgaaccctcaagtattatagcttatgccttgatgtccccagaatatcattttcaattatctgatgatgg |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8253954 |
taaatgacactgtaattccaatatatgatgatgaaccctcaagtattatagcttatgccttgatgtccccagaatatcattttcaattatctgatgatgg |
8254053 |
T |
 |
Q |
301 |
agagagaccaaaag |
314 |
Q |
|
|
|||||||||||||| |
|
|
T |
8254054 |
agagagaccaaaag |
8254067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 921 times since January 2019
Visitors: 3837