View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_45 (Length: 324)
Name: NF0593_low_45
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_45 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 86 - 317
Target Start/End: Original strand, 11715470 - 11715701
Alignment:
| Q |
86 |
gttacatggagtacttaaaaaagaatttatttgcatacctataggtacattgattttccaattttgtgtcttggaaatttttcgatctctccttttgcca |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11715470 |
gttacatggagtacttaaaaaagaatttatttgcatacctataggtacattgattttccaattttgtgtcttggaaatttttcgatctctccttttgcca |
11715569 |
T |
|
| Q |
186 |
ttgctgaaaaggagcnnnnnnntatgaatatcgtctttgaaaaattgatgcaatttctctaaacaaaagcgagaggcataaggttatgtatttacaatgt |
285 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11715570 |
ttgctgaaaaggagcaaaaaaatatgaatatcgtctttgaaaaattgatgcaatttctctaaacaaaagcgagaggcataaggttatgtatttacaatgt |
11715669 |
T |
|
| Q |
286 |
catatattcgagcattccaatcatattcttcg |
317 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
11715670 |
catatattcgagcattccaatcatgttcttcg |
11715701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1283 times since January 2019
Visitors: 3844