View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_46 (Length: 324)
Name: NF0593_low_46
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 116 - 270
Target Start/End: Complemental strand, 757638 - 757489
Alignment:
Q |
116 |
catgaacgaataaagactttatctatatgagtcacaagtggttcgtgaaatacctaactcgttcgtgtgctttcataacgaaaactcttacaaaaaaggt |
215 |
Q |
|
|
||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
757638 |
catgaacgaataaagac---atc--tatgagtcacaagtggttcgtgaaatacctaactcgttcgtgtgctttcataacgaaaactcttacaaaaaaggt |
757544 |
T |
 |
Q |
216 |
ttcttatgtataaagagagctaatgcaagagaaagttcaagtgacacgatttaga |
270 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
T |
757543 |
ttcttatgtataaagagaggtaatgcaagagaaagttcaagtgacacgatttaga |
757489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University