View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_52 (Length: 312)
Name: NF0593_low_52
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 79 - 208
Target Start/End: Complemental strand, 37844868 - 37844739
Alignment:
| Q |
79 |
aataatatagtgatcatttaggttctctgtagcctccaaaactaggtcctgaagggcattgattttattggcatttaagaagtatgatttgggttgataa |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37844868 |
aataatatagtgatcatttaggttctctgtagcctccaaaactaggtcctgaagggcattgattttattggcatttaagaagtatgatttgggttgataa |
37844769 |
T |
|
| Q |
179 |
tacaaggattgttgaaggtgcatatattgg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37844768 |
tacaaggattgttgaaggtgcatatattgg |
37844739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 79 - 123
Target Start/End: Complemental strand, 37837376 - 37837332
Alignment:
| Q |
79 |
aataatatagtgatcatttaggttctctgtagcctccaaaactag |
123 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37837376 |
aataatatactgatcatttaggttctctgtagcctccaaaactag |
37837332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 79 - 133
Target Start/End: Complemental strand, 37843001 - 37842947
Alignment:
| Q |
79 |
aataatatagtgatcatttaggttctctgtagcctccaaaactaggtcctgaagg |
133 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||| ||| ||||| | ||||||| |
|
|
| T |
37843001 |
aataatatattgatcacttaggttctctgtagcctgcaacactagtttctgaagg |
37842947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 79 - 117
Target Start/End: Complemental strand, 36866078 - 36866040
Alignment:
| Q |
79 |
aataatatagtgatcatttaggttctctgtagcctccaa |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
36866078 |
aataatatattgatcatttaggttctctgtagcttccaa |
36866040 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 824 times since January 2019
Visitors: 3837