View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_low_55 (Length: 296)

Name: NF0593_low_55
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_low_55
NF0593_low_55
[»] chr3 (1 HSPs)
chr3 (9-267)||(28251878-28252136)


Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 267
Target Start/End: Complemental strand, 28252136 - 28251878
Alignment:
9 gattatactcaagcagtttattccgccattcacacatgaaggcaagtaatttgggacacacatgaactatttctagtgatatatcttcaatcttcaaata 108  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28252136 gattatactcaagcaatttattccgccattcacacatgaaggcaagtaatttgggacacacatgaactatttctagtgatatatcttcaatcttcaaata 28252037  T
109 atggatatgtttgtcacattcataattaacgaaaaaagacctcccccataacgggcataatcatacatgtatttgttttgtatctcccacgaatattacg 208  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
28252036 atggatatgtttgtcacattcataattaacgaaaaaatacctcccccataacaggcataatcatacatgtatttgttttgtatctcccacgaatattacg 28251937  T
209 gtttgtccaaatagtatgtgatgctcaatgtcaatggagcgtgcttttaagggagaatt 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28251936 gtttgtccaaatagtatgtgatgctcaatgtcaatggagcgtgcttttaagggagaatt 28251878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1236 times since January 2019
Visitors: 3841