View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_55 (Length: 296)
Name: NF0593_low_55
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 267
Target Start/End: Complemental strand, 28252136 - 28251878
Alignment:
Q |
9 |
gattatactcaagcagtttattccgccattcacacatgaaggcaagtaatttgggacacacatgaactatttctagtgatatatcttcaatcttcaaata |
108 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28252136 |
gattatactcaagcaatttattccgccattcacacatgaaggcaagtaatttgggacacacatgaactatttctagtgatatatcttcaatcttcaaata |
28252037 |
T |
 |
Q |
109 |
atggatatgtttgtcacattcataattaacgaaaaaagacctcccccataacgggcataatcatacatgtatttgttttgtatctcccacgaatattacg |
208 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28252036 |
atggatatgtttgtcacattcataattaacgaaaaaatacctcccccataacaggcataatcatacatgtatttgttttgtatctcccacgaatattacg |
28251937 |
T |
 |
Q |
209 |
gtttgtccaaatagtatgtgatgctcaatgtcaatggagcgtgcttttaagggagaatt |
267 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28251936 |
gtttgtccaaatagtatgtgatgctcaatgtcaatggagcgtgcttttaagggagaatt |
28251878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1236 times since January 2019
Visitors: 3841