View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_65 (Length: 281)
Name: NF0593_low_65
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_65 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 32 - 281
Target Start/End: Complemental strand, 45346390 - 45346141
Alignment:
Q |
32 |
aaccctaggttcctccaacacacttcccactcaagaattggttaggcacgttctccaaaatggccatgactccgatctcgatttcaactccaatccatgg |
131 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45346390 |
aaccctaggttcctccaacacacttcccactcaagaattggttaggcacgttctccaaaatggccatgactccgatctcgatttcaactccaatccatgg |
45346291 |
T |
 |
Q |
132 |
ctctctgctcaaggtttcttaattcattcatttccctctcctgctcaatattcaactgttgctcatgtttcttgtctttttcttacagtccatgtggaat |
231 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
45346290 |
ctctctgctcaaggtttcttaattcattcatttccctctcctgctcaatattcaactgttgctcatgtttcttgtctttttcttatagtccatgtggaat |
45346191 |
T |
 |
Q |
232 |
ctgttactcctttgaactcgatcaagaagcatctgaacggtgatggaaaa |
281 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
45346190 |
ctgttactcctttgaactcgatcaagaagcatctgaacggtgaaggaaaa |
45346141 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University