View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_67 (Length: 278)
Name: NF0593_low_67
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_67 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 29 - 243
Target Start/End: Complemental strand, 24779153 - 24778937
Alignment:
| Q |
29 |
aattctttgtgggattgagttaattgattgaatctttagtttctgtttgattttagtttgaaacctatataagggtctttttaatgggtttagtgttgaa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24779153 |
aattctttgtgggattgagttaattgattgaatctttagtttctgtttgattttagtttgaaacctatataagggtctttttaatgggtttagtgttgaa |
24779054 |
T |
|
| Q |
129 |
atatcacgtctg--atttattttcttgatattggagtagtttttcttatttctcatttgtaaaaatgttcttgtaactgttctttaagattttagaagct |
226 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24779053 |
atatcacgtctgatatttattttcttgatattggagtagtttttcttatttctcatttgtaaaaatgttcttgtaactgttctttaagattttagaagct |
24778954 |
T |
|
| Q |
227 |
tgtatgctgagcaggga |
243 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
24778953 |
tgtatgctgagcaggga |
24778937 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 234 times since January 2019
Visitors: 3833