View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_low_72 (Length: 269)

Name: NF0593_low_72
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_low_72
NF0593_low_72
[»] chr1 (1 HSPs)
chr1 (28-241)||(42141207-42141420)


Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 28 - 241
Target Start/End: Complemental strand, 42141420 - 42141207
Alignment:
28 gtgcatgcaagacaaatgaggcttttatccgttattgcctcgttgtctttgtgtttttggtggtggnnnnnnngacagcaccgtataagctagaagggaa 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||    
42141420 gtgcatgcaagacaaatgaggcttttatccgttattgcctcgttgtctttgtgtttttggtggtggtttttttgacagcaccgtataagctagaagggaa 42141321  T
128 aaagaaaggacaatgcagtgaatccacattgctattgctattgctatgtttacagacttacagttaggtccagaattggaccatgctttgtacccaaata 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42141320 aaagaaaggacaatgcagtgaatccacattgctattgctattgctatgtttacagacttacagttaggtccagaattggaccatgctttgtacccaaata 42141221  T
228 aacccgttcggtct 241  Q
    ||||||||||||||    
42141220 aacccgttcggtct 42141207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University