View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_74 (Length: 265)
Name: NF0593_low_74
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0593_low_74 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 1e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 81 - 231
Target Start/End: Original strand, 42396082 - 42396228
Alignment:
| Q |
81 |
ggtttttccaaatataattcattcattccacgcgcnnnnnnnngtaacttgtaagaatcttccctccataaaaggacaaatttaattagggtcctatgat |
180 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| ||| |
|
|
| T |
42396082 |
ggtttttccaaatataattcattc----cacgcgcttttttttgtaacttgtaagaatcttccctccataaaaagacaaatttaattagggtcctacgat |
42396177 |
T |
|
| Q |
181 |
atgtactctataaactgagtaacgatttactaataaaattgttgtttaatt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42396178 |
atgtactctataaactgagtaacgatttactaataaaattgttgtttaatt |
42396228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2959 times since January 2019
Visitors: 3831