View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_76 (Length: 261)
Name: NF0593_low_76
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_76 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 29 - 249
Target Start/End: Complemental strand, 32229761 - 32229543
Alignment:
Q |
29 |
agaatggtagttttcatatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcannnnnnnccttcttgtatttcttaatct |
128 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
32229761 |
agaatggtagttttcatatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcattttttt--ttcttgtatttcttaatct |
32229664 |
T |
 |
Q |
129 |
tcaacaaatttaagtcacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtat |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32229663 |
tcaacaaatttaagtcacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtat |
32229564 |
T |
 |
Q |
229 |
gttgttgattaatttgatatt |
249 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
32229563 |
gttgttgattaatttgatatt |
32229543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University