View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_low_76 (Length: 261)

Name: NF0593_low_76
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_low_76
NF0593_low_76
[»] chr5 (1 HSPs)
chr5 (29-249)||(32229543-32229761)


Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 29 - 249
Target Start/End: Complemental strand, 32229761 - 32229543
Alignment:
29 agaatggtagttttcatatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcannnnnnnccttcttgtatttcttaatct 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||||||||||||    
32229761 agaatggtagttttcatatacgttttgatggttttaaacttgtgaaacttcaagcattgtcgaaaaaactcattttttt--ttcttgtatttcttaatct 32229664  T
129 tcaacaaatttaagtcacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtat 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32229663 tcaacaaatttaagtcacatagatcacattttctctaaaacacaacaagtacgtgtcttaatctttcaatttatcatatttgaatattcaagttgtgtat 32229564  T
229 gttgttgattaatttgatatt 249  Q
    |||||||||||||||||||||    
32229563 gttgttgattaatttgatatt 32229543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2685 times since January 2019
Visitors: 3823