View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_86 (Length: 250)
Name: NF0593_low_86
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_86 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 40 - 215
Target Start/End: Original strand, 3455562 - 3455742
Alignment:
Q |
40 |
gttcactcttttaagactgtcacgacaaaaggggcatgactgtgatcttgctctcctgcaacaaaacnnnnnnnnn-----catgtcaaaatacatacag |
134 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
3455562 |
gttcactcttttaagactgtcacgacaaaaggggcatgactgtgatcttgctctcctgcaacaaaacaaaaaaaaaaaaaacatgtcaaaatacatacag |
3455661 |
T |
 |
Q |
135 |
ctttcaactaaacaagagaacacttgaagaagagacgaatgatgaggcggccacaattttgtagagtaccaagacacattg |
215 |
Q |
|
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3455662 |
ctttcaactaaacaagagaacacttgaaggagagacgaatgatgaggcggccacaattttgtagagtaccaagacacattg |
3455742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 399 times since January 2019
Visitors: 3834