View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_87 (Length: 248)
Name: NF0593_low_87
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_87 |
 |  |
|
[»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 14 - 248
Target Start/End: Original strand, 8253452 - 8253686
Alignment:
Q |
14 |
gaacaacctaatctttcgatcagcaaaagtataaatgaccaatctgaccttttagaacctgaattgggtgttcgcagagctctctctgaggggccatttc |
113 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8253452 |
gaacaacctaatctttcgatcagcaaaagtataaatgaccaatctgaccttttagaacctgaattgggtgttcgcagagctctctctgaggggccatttc |
8253551 |
T |
 |
Q |
114 |
ctgtcgtacctagtttgtctgaaacacttgatgctaaatggacaggtgaaaaccagtcaggaatcggaactcaaaaggatagcacttctgtaaaccctga |
213 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8253552 |
ctgtcgtacctagtttgtctgaaacacttgatgctaaatggacaggtgaaaaccagtcaggaatcggaactcaaaaggatagcacttctgtaaaccctga |
8253651 |
T |
 |
Q |
214 |
tacatctaccgcagatgctctgacggccactgtac |
248 |
Q |
|
|
||||||||| ||||||||||||||||||||||||| |
|
|
T |
8253652 |
tacatctacggcagatgctctgacggccactgtac |
8253686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1149 times since January 2019
Visitors: 3840