View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_89 (Length: 233)
Name: NF0593_low_89
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_89 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 12 - 223
Target Start/End: Original strand, 16348204 - 16348415
Alignment:
Q |
12 |
acagagagaatcctttctgggttttcgcgcgtggagcataaaccatgaatgagcatgtcccacgcgccaaatggggtgtgtggattttgcatcatgaatt |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16348204 |
acagagagaatcctttctgggttttcgcgcgtggagcataaaccatgaatgagcatgtcccacgcgccaaatggggtgtgtggattttgcatcatgaatt |
16348303 |
T |
 |
Q |
112 |
gttctgcttggttgaaactgtgtgaattgagaagtgcccatgtgaggattttgtgggatttgtgagggatttggattttgttgaaggtgaattgatggaa |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16348304 |
gttctgcttggttgaaactgtgtgaattgagaagtgcccatgtgaggattttgtgagttttgtgagggatttggattttgttgaaggtgaattgatggaa |
16348403 |
T |
 |
Q |
212 |
gaggttgatgat |
223 |
Q |
|
|
|||||||||||| |
|
|
T |
16348404 |
gaggttgatgat |
16348415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 14 - 125
Target Start/End: Complemental strand, 47916875 - 47916760
Alignment:
Q |
14 |
agagagaatcctttctgggttttcgcgcgt----ggagcataaaccatgaatgagcatgtcccacgcgccaaatggggtgtgtggattttgcatcatgaa |
109 |
Q |
|
|
||||| ||||||||||||||||| || ||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
47916875 |
agagataatcctttctgggttttggcacgtagaggcagcataaaccatgaatgagcatgtcccacgcgcgaaatggggtgtgtggattttgcatcatgaa |
47916776 |
T |
 |
Q |
110 |
ttgttctgcttggttg |
125 |
Q |
|
|
|| ||||||||||||| |
|
|
T |
47916775 |
tttttctgcttggttg |
47916760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 544 times since January 2019
Visitors: 3835