View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0593_low_93 (Length: 211)
Name: NF0593_low_93
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0593_low_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 6)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 42203185 - 42202994
Alignment:
Q |
1 |
gattttctgtgagcacgcagtctttcagtttcctaagaagggatgagacggtttcaaaattgtcttctactcttctagttctccgttgcctattatgacc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
T |
42203185 |
gattttctgtgagcacgcagtctttcagtttcctaagaagggatgagacggtttcaaaactgtcttcta--------gttctccgttgcctattatgacc |
42203094 |
T |
 |
Q |
101 |
aattcgtgtaattcttagtcctcagatgcagcttctcagatgcaacttctcagagagccttttgagtataacaggatcagggtctttatctatctctgct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
42203093 |
aattcgtgtaattcttagtcctcagatgcagcttctcagatgcaacttctcagagagccttttgagtataacaggatcagggtctttatctatctgtgct |
42202994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 1 - 200
Target Start/End: Complemental strand, 42212053 - 42211862
Alignment:
Q |
1 |
gattttctgtgagcacgcagtctttcagtttcctaagaagggatgagacggtttcaaaattgtcttctactcttctagttctccgttgcctattatgacc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
T |
42212053 |
gattttctgtgagcacgcagtctttcagtttcctaagaagggatgagacggtttcaaaactgtcttcta--------gttctccgttgcctattatgacc |
42211962 |
T |
 |
Q |
101 |
aattcgtgtaattcttagtcctcagatgcagcttctcagatgcaacttctcagagagccttttgagtataacaggatcagggtctttatctatctctgct |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
42211961 |
aattcgtgtaattcttagtcctcagatgcagcttctcagatgcaacttctcagagagccttttgagtataacaggatcagggtctttatctatctgtgct |
42211862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 42421201 - 42421306
Alignment:
Q |
1 |
gattttctgtgagcacgcagtctttcagtttcctaagaagggatgagacggtttcaaaattgtcttctactcttctagttctccgttgcctattatgacc |
100 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| || ||| ||||||||||||||| | |||||||| |
|
|
T |
42421201 |
gattttctgcgagcacgcagtctttcagtttcctaagaagagatgagacggtttcaaaactg--------tctcctagttctccgttgcttgttatgacc |
42421292 |
T |
 |
Q |
101 |
aattcgtgtaattc |
114 |
Q |
|
|
||||| |||||||| |
|
|
T |
42421293 |
aattcatgtaattc |
42421306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 135 - 200
Target Start/End: Original strand, 42421338 - 42421403
Alignment:
Q |
135 |
ctcagatgcaacttctcagagagccttttgagtataacaggatcagggtctttatctatctctgct |
200 |
Q |
|
|
||||||||||||||||||||||| |||||||||||| |||||||||||||||||||| ||| |||| |
|
|
T |
42421338 |
ctcagatgcaacttctcagagagtcttttgagtatagcaggatcagggtctttatctttctgtgct |
42421403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 42218027 - 42217915
Alignment:
Q |
1 |
gattttctgtgagcacgcagtctttcagtttcctaagaagggatgagacggtttcaaaattgtcttctactcttctagttctccgttgcctattatgacc |
100 |
Q |
|
|
||||||||| ||||| ||||| |||||||||||||||||||||||||| |||||||| || || ||| ||||||||||||| | | |||||||| |
|
|
T |
42218027 |
gattttctgcgagcatgcagtttttcagtttcctaagaagggatgagatggtttcaactttcaaaact-gtctcctagttctccgttactttttatgacc |
42217929 |
T |
 |
Q |
101 |
aattcgtgtaattc |
114 |
Q |
|
|
|||||||||||||| |
|
|
T |
42217928 |
aattcgtgtaattc |
42217915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 200
Target Start/End: Complemental strand, 42217878 - 42217818
Alignment:
Q |
140 |
atgcaacttctcagagagccttttgagtataacaggatcagggtctttatctatctctgct |
200 |
Q |
|
|
|||||||||||||| | | |||||||| ||| |||||||||||||||||||| ||| |||| |
|
|
T |
42217878 |
atgcaacttctcagtgggtcttttgaggatagcaggatcagggtctttatctttctgtgct |
42217818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University