View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0593_low_95 (Length: 204)

Name: NF0593_low_95
Description: NF0593
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0593_low_95
NF0593_low_95
[»] chr6 (6 HSPs)
chr6 (1-133)||(3575625-3575757)
chr6 (1-133)||(3585461-3585593)
chr6 (11-133)||(3572351-3572473)
chr6 (1-134)||(3563646-3563779)
chr6 (1-134)||(3569294-3569427)
chr6 (10-132)||(13275587-13275708)


Alignment Details
Target: chr6 (Bit Score: 129; Significance: 6e-67; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 3575625 - 3575757
Alignment:
1 aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3575625 aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga 3575724  T
101 agaatcaccatgaggaaaacaaccaccaagaag 133  Q
    ||||||||||||||||||||||||| |||||||    
3575725 agaatcaccatgaggaaaacaaccaacaagaag 3575757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 3585593 - 3585461
Alignment:
1 aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga 100  Q
    |||||||| ||||||| | ||||||||||||||||| |||||| |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||    
3585593 aaatactacaatggctgcttcaacaatggctctctcatcttcatcaatggttggaaaggcaatcaagctttccccttcgactccagaccttgtgatggga 3585494  T
101 agaatcaccatgaggaaaacaaccaccaagaag 133  Q
    |||||||||||||||||||||||||||||||||    
3585493 agaatcaccatgaggaaaacaaccaccaagaag 3585461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 11 - 133
Target Start/End: Original strand, 3572351 - 3572473
Alignment:
11 atggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatgggaagaatcacca 110  Q
    |||||| | ||||||||| |||||||||||||| || |||||||||||||||||||||||||||| || |||||||||||||| ||||||||||| ||||    
3572351 atggctgcttcaacaatgtctctctcttcttcatcattggttgggaaggcaatcaagctttccccctctactccagaccttgtcatgggaagaattacca 3572450  T
111 tgaggaaaacaaccaccaagaag 133  Q
    |||||||||||||||||||||||    
3572451 tgaggaaaacaaccaccaagaag 3572473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 3563646 - 3563779
Alignment:
1 aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga 100  Q
    |||||||| ||||||  | ||||||||| |||||||||||||| || | || ||||||||||||||||||||||| ||||| | |||| ||| | |||||    
3563646 aaatactaaaatggcggcttcaacaatgtctctctcttcttcatcatttgtagggaaggcaatcaagctttccccatccacccaagacattggggtggga 3563745  T
101 agaatcaccatgaggaaaacaaccaccaagaagt 134  Q
    ||| |||| ||||||||| |||||||||||||||    
3563746 agagtcacaatgaggaaagcaaccaccaagaagt 3563779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 3569294 - 3569427
Alignment:
1 aaatactagaatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatggga 100  Q
    |||||| | ||||||| | ||||||||| | |||||||||||| || | || |||||||||||||| |||||||| ||||||| |||| ||| | |||||    
3569294 aaataccacaatggctgcttcaacaatgtccctctcttcttcatcatttgtcgggaaggcaatcaaactttccccatccactcaagacattggggtggga 3569393  T
101 agaatcaccatgaggaaaacaaccaccaagaagt 134  Q
    ||| |||| |||||||||||||||||||||||||    
3569394 agagtcacaatgaggaaaacaaccaccaagaagt 3569427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 10 - 132
Target Start/End: Original strand, 13275587 - 13275708
Alignment:
10 aatggctacatcaacaatggctctctcttcttcaacaatggttgggaaggcaatcaagctttccccttccactccagaccttgtgatgggaagaatcacc 109  Q
    ||||||| | ||||||||| |||||||||||||| || ||||||| ||||||||||| |||  ||| || || | ||||||||  || |||||  |||||    
13275587 aatggctgcctcaacaatgtctctctcttcttcatcattggttggaaaggcaatcaaacttaacccctctacccaagaccttggtattggaagggtcacc 13275686  T
110 atgaggaaaacaaccaccaagaa 132  Q
    ||||  ||||||||||| |||||    
13275687 atga-aaaaacaaccacaaagaa 13275708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University