View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_high_16 (Length: 441)
Name: NF0594_high_16
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0594_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 34 - 412
Target Start/End: Complemental strand, 8458708 - 8458324
Alignment:
Q |
34 |
cagagagtgaatcaagagcatgagtttaggattttaatcggaaaatgcaatgtgttattgccnnnnnnnnnnnnnnnnnngaaggtataagtaaaatgat |
133 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
T |
8458708 |
cagagagtgaatcaagagcatgagtttaggattttaatcggaaaatgcaatgtgttattgccaaaaaaattataaaaaaagaaggtataagtaaaatgat |
8458609 |
T |
 |
Q |
134 |
gtagaagaaaatgtcatattcgcagtgggtaa------ccttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaattcac |
227 |
Q |
|
|
|||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8458608 |
gtagaagaaaatgtcatattcgcagtggttaaaaggcaccttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaattcac |
8458509 |
T |
 |
Q |
228 |
atagcaaaatttatttccaaatgcaaaattaattttacataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcatata |
327 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8458508 |
atagcaaaatttatttccaaatgcaaaattaattttacataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcatata |
8458409 |
T |
 |
Q |
328 |
aatttgcgctgaccatacacacccccacttgagcatgtatttcagtgtgttattttgagaaatagtgaactaagaacctgagttg |
412 |
Q |
|
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
8458408 |
aagttgcgctgaccatacacacccccacttgagcatgtatttcagtgtgttattttgagaaatagtgaactaaaaacctgagttg |
8458324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1353 times since January 2019
Visitors: 3844