View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_high_21 (Length: 377)
Name: NF0594_high_21
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_high_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 10 - 212
Target Start/End: Complemental strand, 53677952 - 53677750
Alignment:
| Q |
10 |
ttatatactctgaattgaaaaatcagcataataatttaacaaatctttaagtgaaagttgcacatgctcataaggcaattcttattctggaagctataaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53677952 |
ttatatactctgaattgaaaaatcagcataataatttaacaaatctttaagtgaaagttgcacatgctcataaggcaattcttattctggaagctataaa |
53677853 |
T |
|
| Q |
110 |
tggattttgaatattcttggaagaggggaaataaaaaaggaatccattannnnnnnnnnnnataccacgctaggaaggtcatctgttttaaagtagagta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
53677852 |
tggattttgaatattcttggaagaggggaaataaaaaaggaatccattcttttttatttttataccacgctagaaaggtcatctgttttaaagtagagta |
53677753 |
T |
|
| Q |
210 |
aat |
212 |
Q |
| |
|
||| |
|
|
| T |
53677752 |
aat |
53677750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 283 - 366
Target Start/End: Complemental strand, 53677399 - 53677316
Alignment:
| Q |
283 |
accacattttaatattttgaaattgccaaatattaatcattttacttcttcgtttgaacttgattaacttagttttgtattcat |
366 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53677399 |
accacattttaatattttgaaattgccaaatattaatcattttacttcttcgtttgaacttgattaacttagttttgtattcat |
53677316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1467 times since January 2019
Visitors: 3846