View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_high_26 (Length: 313)
Name: NF0594_high_26
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 3 - 284
Target Start/End: Complemental strand, 8458611 - 8458324
Alignment:
| Q |
3 |
gatgtcgaagaatatgtcatattcgcagtgggtaa------ccttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaatt |
96 |
Q |
| |
|
||||| |||||| |||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458611 |
gatgtagaagaaaatgtcatattcgcagtggttaaaaggcaccttattaatcagtaacctttaaacctaaatatcccttctattccttaatatttcaatt |
8458512 |
T |
 |
| Q |
97 |
cacatagcaaaatttatttccaaatgcaaaattaattttacataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcat |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8458511 |
cacatagcaaaatttatttccaaatgcaaaattaattttacataaatcaattataccataaccaggcttgtagtttccatacgaaataagaaaaatgcat |
8458412 |
T |
 |
| Q |
197 |
ataaatttgcgctgaccatacacacccccacttgagcatgtatttcagtgtgttattttgagaaatagtgaactaagaacctgagttg |
284 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8458411 |
ataaagttgcgctgaccatacacacccccacttgagcatgtatttcagtgtgttattttgagaaatagtgaactaaaaacctgagttg |
8458324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University