View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_high_30 (Length: 291)
Name: NF0594_high_30
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0594_high_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 176 - 286
Target Start/End: Original strand, 18949585 - 18949695
Alignment:
Q |
176 |
gatccagattgatgacactttccaacaacccgatccaccttgagtgtacttgcaacccgatcaagaccaccatacaatgcattgctgtaacggatcatgt |
275 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
18949585 |
gatccagattgatgacactttccaacaacccgatccaccttgagtgtacttgcaacccgatcaagaccaccatacaatgcattgctgtagcggatcatgt |
18949684 |
T |
 |
Q |
276 |
gtttcatatca |
286 |
Q |
|
|
||||||||||| |
|
|
T |
18949685 |
gtttcatatca |
18949695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 7847385 - 7847290
Alignment:
Q |
1 |
tcacagttgtaacttaaacttgcattttgttttgaatttcagttttgttaaattccaataagaatctacatgaatggatatgttgaatgatcgttta |
97 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
7847385 |
tcacagttgtaacttaaacttgcattttgttttgaatttcagttttgttaaattccaataagaatctacatgaat-gatatgttgaatgatcgttta |
7847290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University