View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0594_high_41 (Length: 203)

Name: NF0594_high_41
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0594_high_41
NF0594_high_41
[»] chr8 (1 HSPs)
chr8 (24-108)||(941678-941762)


Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 24 - 108
Target Start/End: Complemental strand, 941762 - 941678
Alignment:
24 ctcatccttcacaatattcatttggatgagttgaagatctcttagttgatgatacctctgaagtcacttcccctaggcttgttat 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
941762 ctcatccttcacaatattcatttggatgagttgaagatctcttagttgatgatacctctgaagtcacttcccctaggcttgttat 941678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University