View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_19 (Length: 392)
Name: NF0594_low_19
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 9 - 363
Target Start/End: Original strand, 28598021 - 28598375
Alignment:
| Q |
9 |
caacaatatccctattgccttcacatctgatccaacattacattcattattgcactcatgaagaccaaacagtttaatctttgcaacaagattgttgtct |
108 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28598021 |
caacaaaacccctattgccttcacatctgatccaacattacattcattattgcactcatgaagaccaaacagtttgatctttgcaacaagattgttgtct |
28598120 |
T |
 |
| Q |
109 |
aggaggatgttggatggagaaatatgacaatgagtaatgggcctgggctgaaatgagtttataaagcccagcccggaacaaacttctatggctatcctta |
208 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| ||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28598121 |
aggaggatgttggatggagaaacatgacaatgagttatgggcctgggctgaaatgagcttagaaagcccagcccagaacaaacttctatggctatcctta |
28598220 |
T |
 |
| Q |
209 |
tgcaatcttgccagcttatgaacttctttcttgtcttgcaaggtaggttttcttccaaactgccattgtgcatgtattccaatactaagcatttgggctc |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28598221 |
tgcaatcttgccagcttatgaacttctttcttgtcttgcaaggtaggttttcttccaaactgccattgtgcatgtattccaatactaagcatttgggctc |
28598320 |
T |
 |
| Q |
309 |
agagcagaatccaagtatagcaaccagatgaggatgtcgaatactaccaagtgac |
363 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28598321 |
agagcagaatccaagtataccaaccagatgaggatgtcgaatactaccaagtgac |
28598375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University