View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0594_low_30 (Length: 335)

Name: NF0594_low_30
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0594_low_30
NF0594_low_30
[»] chr1 (1 HSPs)
chr1 (95-249)||(3744535-3744689)


Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 95 - 249
Target Start/End: Complemental strand, 3744689 - 3744535
Alignment:
95 agtgtatgtgtgatggtctttgggggcagaagagtaccaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagta 194  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3744689 agtgtatgtgtgatggtctttgggggcagaagagtactaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagta 3744590  T
195 attttgatttgcaatgcagttattctgtttctgtgattgtgattgttcttgttct 249  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
3744589 attttgatttgcaatgcagttattctgtttctgtgattttgattgttcttgttct 3744535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1341 times since January 2019
Visitors: 3844