View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_32 (Length: 328)
Name: NF0594_low_32
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0594_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 86 - 215
Target Start/End: Original strand, 37844519 - 37844648
Alignment:
Q |
86 |
atgaaattgaaagctggttggatatatttttagttttaattgtttaagttgacattttggattttatatcactggagtgatttgaactattttaagtgga |
185 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37844519 |
atgaaattgaaagctggttagatatatttttagttttaattgtttaagttgacattttggattttatatcactggagtgatttgaactattttaagtgga |
37844618 |
T |
 |
Q |
186 |
agaacaattaaccactactatgaaaataaa |
215 |
Q |
|
|
|||||||||||||||||||| ||||||||| |
|
|
T |
37844619 |
agaacaattaaccactactaagaaaataaa |
37844648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 240 - 283
Target Start/End: Original strand, 37844770 - 37844813
Alignment:
Q |
240 |
tgatttttagtggtatgatattgcaaatctctgactattaattt |
283 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37844770 |
tgatttttagtggtatgatattgcaaatctctgactattaattt |
37844813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2919 times since January 2019
Visitors: 3831