View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0594_low_34 (Length: 322)

Name: NF0594_low_34
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0594_low_34
NF0594_low_34
[»] chr5 (1 HSPs)
chr5 (157-308)||(18949544-18949695)
[»] chr8 (1 HSPs)
chr8 (177-308)||(40871675-40871806)
[»] chr3 (1 HSPs)
chr3 (170-270)||(54703738-54703838)


Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 157 - 308
Target Start/End: Original strand, 18949544 - 18949695
Alignment:
157 gcaccaacttatcaaaagtgtgccatgtcaacaagctatcagatccagattgatgacactttccaacaacccgatccaccttgagtgtacttgcaacccg 256  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18949544 gcaccaacttatcaaaagtgtgccatgtcaacaagctatcggatccagattgatgacactttccaacaacccgatccaccttgagtgtacttgcaacccg 18949643  T
257 atcaagaccaccatacaatgcattgctgtaacggatcatgtgtttcatatca 308  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||    
18949644 atcaagaccaccatacaatgcattgctgtagcggatcatgtgtttcatatca 18949695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 177 - 308
Target Start/End: Original strand, 40871675 - 40871806
Alignment:
177 tgccatgtcaacaagctatcagatccagattgatgacactttccaacaacccgatccaccttgagtgtacttgcaacccgatcaagaccaccatacaatg 276  Q
    |||||||||||||| ||||| ||||||| ||||||  ||||||||||| | |||  ||| || |||||||| || || || || |||||||||||||| |    
40871675 tgccatgtcaacaaactatctgatccagcttgatgcgactttccaacagctcgacacacattaagtgtactagcgactcgctcgagaccaccatacaaag 40871774  T
277 cattgctgtaacggatcatgtgtttcatatca 308  Q
    | |||| | | |  ||||||||||||||||||    
40871775 cgttgcagaacctcatcatgtgtttcatatca 40871806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 170 - 270
Target Start/End: Original strand, 54703738 - 54703838
Alignment:
170 aaaagtgtgccatgtcaacaagctatcagatccagattgatgacactttccaacaacccgatccaccttgagtgtacttgcaacccgatcaagaccacca 269  Q
    |||||| |||||||| || || ||||||||||||| ||||||  |||||||||   |||||||||| | |||  || | |||||||| ||||||||||||    
54703738 aaaagtctgccatgttaataaactatcagatccagcttgatgtgactttccaatggcccgatccacgtcgagaatattagcaacccgttcaagaccacca 54703837  T
270 t 270  Q
    |    
54703838 t 54703838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 707 times since January 2019
Visitors: 3837