View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_36 (Length: 312)
Name: NF0594_low_36
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 95 - 229
Target Start/End: Complemental strand, 3744689 - 3744555
Alignment:
| Q |
95 |
agtgtatgtgtgatggtctttgggggcagaagagtaccaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagta |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744689 |
agtgtatgtgtgatggtctttgggggcagaagagtactaggttgttttttaaggtcgtgcttgtgtgatggtatttggtttgatgtaataaaaattagta |
3744590 |
T |
|
| Q |
195 |
attttgatttgcaatgcagttattctgtttctgtg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3744589 |
attttgatttgcaatgcagttattctgtttctgtg |
3744555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1065 times since January 2019
Visitors: 3839