View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0594_low_39 (Length: 292)
Name: NF0594_low_39
Description: NF0594
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0594_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 9 - 263
Target Start/End: Original strand, 24261184 - 24261438
Alignment:
| Q |
9 |
agcacagatagttatcttacacagttatatagattaatagtgcgatgtgtctgatcattattatagccgttgtctttgtgaaattgcttagtgaccatgt |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24261184 |
agcaaagatagttatcttacacagttatatagattaatagtgcgatgtgtctgatcattattatagccgttgtctttgtgaaattgcttagtgaccatgt |
24261283 |
T |
|
| Q |
109 |
catcgtagtttaggaatttaaacttctatgttgctattcaaatgtaatattgattaatctaacccttaaaatgcaatcttttagatgcaaacaagtggaa |
208 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24261284 |
catcgcaatttaggaatttaaacttctatgttgctattcaaatgtaatattgattaatctaacccttaaaatgcaatcttttagatgcaaacaagtggaa |
24261383 |
T |
|
| Q |
209 |
gattagtgtgagtatccacaatcaaacttaatcgagtgtttttggcaccggatga |
263 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24261384 |
gattagtgtgagtatccgcaatcaaacttaatcgagtatttttggcaccggatga |
24261438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2954 times since January 2019
Visitors: 3831